home *** CD-ROM | disk | FTP | other *** search
- /* File: ureadseq.c
- *
- * Reads and writes nucleic/protein sequence in various
- * formats. Data files may have multiple sequences.
- *
- * Copyright 1990 by d.g.gilbert
- * biology dept., indiana university, bloomington, in 47405
- * e-mail: gilbertd@bio.indiana.edu
- *
- * This program may be freely copied and used by anyone.
- * Developers are encourged to incorporate parts in their
- * programs, rather than devise their own private sequence
- * format.
- *
- * This should compile and run with any ANSI C compiler.
- *
- */
-
-
- #include <stdio.h>
- #include <ctype.h>
- #include <string.h>
- #include <stdlib.h>
-
- #define UREADSEQ_G
- #include "ureadseq.h"
-
-
-
- int Strcasecmp(const char *a, const char *b) /* from Nlm_StrICmp */
- {
- int diff, done;
- if (a == b) return 0;
- done = 0;
- while (! done) {
- diff = to_upper(*a) - to_upper(*b);
- if (diff) return diff;
- if (*a == '\0') done = 1;
- else { a++; b++; }
- }
- return 0;
- }
-
- int Strncasecmp(const char *a, const char *b, long maxn) /* from Nlm_StrNICmp */
- {
- int diff, done;
- if (a == b) return 0;
- done = 0;
- while (! done) {
- diff = to_upper(*a) - to_upper(*b);
- if (diff) return diff;
- if (*a == '\0') done = 1;
- else {
- a++; b++; maxn--;
- if (! maxn) done = 1;
- }
- }
- return 0;
- }
-
-
-
- # define MALLOC(size) (char*)malloc(size)
- # define REALLOC(p,size) p= (char*)realloc(p,size)
-
- #ifndef Local
- # define Local static /* local functions */
- #endif
-
- #define kStartLength 500 /* 500000 to temp fix Unix bug */
-
- const char *aminos = "ABCDEFGHIKLMNPQRSTVWXYZ*";
- const char *primenuc = "ACGTU";
- const char *protonly = "EFIPQZ";
-
- const char kNocountsymbols[5] = "_.-?";
- const char stdsymbols[6] = "_.-*?";
- const char allsymbols[32] = "_.-*?<>{}[]()!@#$%^&=+;:'/|`~\"\\";
- static const char *seqsymbols = allsymbols;
-
- const char nummask[11] = "0123456789";
- const char nonummask[11] = "~!@#$%^&*(";
-
- FILE * gFile;
- long gLinestart = 0;
-
-
-
-
- /*
- use general form of isseqchar -- all chars + symbols.
- no formats except nbrf (?) use symbols in data area as
- anything other than sequence chars.
- */
-
-
-
- /* Local variables for readSeq: */
- struct ReadSeqVars {
- short choice, err, nseq;
- long seqlen, maxseq, seqlencount;
- short topnseq;
- long topseqlen;
- const char *fname;
- char *seq, *seqid, matchchar;
- boolean allDone, done, filestart, addit;
- FILE *f;
- long linestart;
- char s[256], *sp;
-
- int (*isseqchar)(int);
- ReadWriteProc reader;
- };
-
-
-
- #define EOFreader(V) (boolean)(*V->reader)((char *)NULL, 0L, kRSFile_Eof)
- #define REWINDreader(V) (*V->reader)((char *)NULL, 0L, kRSFile_Rewind)
-
- Local long readWriteFromFile(char* line, long maxline, short action)
- {
- static boolean geof = false;
- long bytes;
- /*fprintf(stderr," r/w action= %d, maxline= %ld ", action, maxline);*/
- /* ! one case where _Read returns 0 bytes at end of file, but _Eof returns false !! */
-
- switch (action) {
-
- case kRSFile_Eof:
- if (geof) { /* fix for bad feof() ! */
- char ch= fgetc( gFile);
- if (ch != EOF) { ungetc( ch, gFile); geof= false; }
- }
- else geof= feof( gFile);
- return geof;
-
- case kRSFile_Read:
- bytes= (long) fgets (line, (int)maxline, gFile);
- if (!bytes) geof= true; /* fix for bad feof() ! */
- return bytes;
-
- case kRSFile_Write:
- geof= false;
- fputs( line, gFile);
- return 0;
-
- case kRSFile_Seek:
- geof= false;
- fseek( gFile, maxline, 0);
- return 0;
-
- case kRSFile_Rewind:
- rewind(gFile);
- geof= false;
- return 0;
-
- case kRSFile_Tell:
- return ftell(gFile);
-
- default:
- return 0;
- }
- }
-
-
-
-
- int isSeqChar(int c)
- {
- /* return (isalpha(c) || strchr(seqsymbols,c)); */
- if (isalpha(c) || strchr(seqsymbols,c)) return c;
- else return 0;
- }
-
- int isGCGSeqChar(int c)
- {
- /* return (isalpha(c) || strchr(seqsymbols,c)); */
- if (isalpha(c) || strchr(seqsymbols,c)) {
- if (c == '.') return '-'; /* do the indel translate */
- else return c;
- }
- else return 0;
- }
-
- int isSeqNumChar(int c)
- {
- /* return (isalnum(c) || strchr(seqsymbols,c)); */
- if (isalnum(c) || strchr(seqsymbols,c)) return c;
- else return 0;
- }
-
-
- int isAnyChar(int c)
- {
- /* return isprint(c); /* wrap in case isascii is macro */
- if (isprint(c)) return c;
- else return 0;
- }
-
-
- Local void callreadline( ReadWriteProc reader, char *s)
- {
- char *cp;
-
- /*fprintf(stderr,"callreadline &reader= %ld \n", reader);*/
-
- gLinestart= (*reader)( (char*)NULL, 0L, kRSFile_Tell);
- if (0 == (*reader)( s, 256L, kRSFile_Read) )
- *s = 0;
- else {
- cp = strchr(s, '\n');
- if (cp != NULL) *cp = 0;
- }
- }
-
- /********
- Local void readline(FILE *f, char *s, long *linestart)
- {
- char *cp;
-
- *linestart= ftell(f);
- if (NULL == fgets(s, 256, f))
- *s = 0;
- else {
- cp = strchr(s, '\n');
- if (cp != NULL) *cp = 0;
- }
- }
- ******/
-
- Local void getline(struct ReadSeqVars *V)
- {
- /*readline(V->f, V->s, &V->linestart); */
- callreadline(V->reader, V->s);
- }
-
- Local void ungetline(struct ReadSeqVars *V)
- {
- /*fseek(V->f, V->linestart, 0); */
- (void) (*(V->reader))( (char*)NULL, gLinestart, kRSFile_Seek);
- }
-
-
- Local void addseq(char *s, struct ReadSeqVars *V)
- {
- char *ptr;
- register char seqc;
-
- if (V->addit) while (*s != 0) {
- if ((seqc= (V->isseqchar)(*s)) != 0) {
- if (V->seqlen >= V->maxseq) {
- V->maxseq += kStartLength;
- #ifdef NOTmacintosh
- SetPtrSize( (Ptr)V->seq, V->maxseq+1);
- if (MemError() != 0) {
- V->err = eMemFull;
- return;
- }
- #else
- ptr = (char*) realloc(V->seq, V->maxseq+1);
- if (ptr==NULL) {
- V->err = eMemFull;
- return;
- }
- else V->seq = ptr;
- #endif
- }
- V->seq[(V->seqlen)++] = seqc; /* *s */
- }
- s++;
- }
- }
-
- Local void countseq(char *s, struct ReadSeqVars *V)
- /* this must count all valid seq chars, for some formats (paup-sequential) even
- if we are skipping seq... */
- {
- while (*s != 0) {
- if ((V->isseqchar)(*s)) {
- (V->seqlencount)++;
- }
- s++;
- }
- }
-
-
- Local void addinfo(char *s, struct ReadSeqVars *V)
- {
- char s2[256], *si;
- boolean saveadd;
- int (*oldIsSeqChar)(int);
-
- si = s2;
- while (*s == ' ') s++;
- sprintf(si, " %d) %s\n", V->nseq, s);
-
- saveadd = V->addit;
- V->addit = true;
- oldIsSeqChar= V->isseqchar;
- V->isseqchar = isAnyChar;
- addseq( si, V);
- V->addit = saveadd;
- V->isseqchar = oldIsSeqChar;
- }
-
-
-
-
- Local void readLoop(short margin, boolean addfirst,
- boolean (*endTest)(boolean *addend, boolean *ungetend, struct ReadSeqVars *V),
- struct ReadSeqVars *V)
- {
- boolean addend = false;
- boolean ungetend = false;
-
- V->nseq++;
- if (V->choice == kListSequences) V->addit = false;
- else V->addit = (V->nseq == V->choice);
- if (V->addit) V->seqlen = 0;
-
- if (addfirst) addseq(V->s, V);
- do {
- getline(V);
- V->done = EOFreader(V); /* feof(V->f); */
- V->done |= (*endTest)( &addend, &ungetend, V);
- if (V->addit && (addend || !V->done) && (strlen(V->s) > margin)) {
- addseq( (V->s)+margin, V);
- }
- } while (!V->done);
-
- if (V->choice == kListSequences) addinfo(V->seqid, V);
- else {
- V->allDone = (V->nseq >= V->choice);
- if (V->allDone && ungetend) ungetline(V);
- }
- }
-
-
-
- Local boolean endIG( boolean *addend, boolean *ungetend, struct ReadSeqVars *V)
- {
- *addend = true; /* 1 or 2 occur in line w/ bases */
- *ungetend= false;
- return((strchr(V->s,'1')!=NULL) || (strchr(V->s,'2')!=NULL));
- }
-
- Local void readIG(struct ReadSeqVars *V)
- {
- /* 18Aug92: new IG format -- ^L between sequences in place of ";" */
- char *si;
-
- while (!V->allDone) {
- do {
- getline(V);
- for (si= V->s; *si != 0 && *si < ' '; si++) *si= ' '; /* drop controls */
- if (*si == 0) *V->s= 0; /* chop line to empty */
- } while (! (EOFreader(V) || ((*V->s != 0) && (*V->s != ';') ) ));
- if (EOFreader(V))
- V->allDone = true;
- else {
- strcpy(V->seqid, V->s);
- readLoop(0, false, endIG, V);
- }
- }
- }
-
-
-
- Local boolean endStrider( boolean *addend, boolean *ungetend, struct ReadSeqVars *V)
- {
- *addend = false;
- *ungetend= false;
- return (strstr( V->s, "//") != NULL);
- }
-
- Local void readStrider(struct ReadSeqVars *V)
- { /* ? only 1 seq/file ? */
-
- while (!V->allDone) {
- getline(V);
- if (strstr(V->s,"; DNA sequence ") == V->s)
- strcpy(V->seqid, (V->s)+16);
- else
- strcpy(V->seqid, (V->s)+1);
- while ((!EOFreader(V)) && (*V->s == ';')) {
- getline(V);
- }
- if (EOFreader(V)) V->allDone = true;
- else readLoop(0, true, endStrider, V);
- }
- }
-
-
- Local boolean endPIR( boolean *addend, boolean *ungetend, struct ReadSeqVars *V)
- {
- *addend = false;
- *ungetend= (strstr(V->s,"ENTRY") == V->s);
- return ((strstr(V->s,"///") != NULL) || *ungetend);
- }
-
- Local void readPIR(struct ReadSeqVars *V)
- { /*PIR -- many seqs/file */
-
- while (!V->allDone) {
- while (! (EOFreader(V)
- || strstr(V->s,"ENTRY") || strstr(V->s,"SEQUENCE")) )
- getline(V);
- strcpy(V->seqid, (V->s)+16);
- while (! (EOFreader(V) || strstr(V->s,"SEQUENCE") == V->s))
- getline(V);
- readLoop(0, false, endPIR, V);
-
- if (!V->allDone) {
- while (! (EOFreader(V) || ((*V->s != 0)
- && (strstr( V->s,"ENTRY") == V->s))))
- getline(V);
- }
- if (EOFreader(V)) V->allDone = true;
- }
- }
-
-
- Local boolean endGB( boolean *addend, boolean *ungetend, struct ReadSeqVars *V)
- {
- *addend = false;
- *ungetend= (strstr(V->s,"LOCUS") == V->s);
- return ((strstr(V->s,"//") != NULL) || *ungetend);
- }
-
- Local void readGenBank(struct ReadSeqVars *V)
- { /*GenBank -- many seqs/file */
-
- while (!V->allDone) {
- strcpy(V->seqid, (V->s)+12);
- while (! (EOFreader(V) || strstr(V->s,"ORIGIN") == V->s))
- getline(V);
- readLoop(0, false, endGB, V);
-
- if (!V->allDone) {
- while (! (EOFreader(V) || ((*V->s != 0)
- && (strstr( V->s,"LOCUS") == V->s))))
- getline(V);
- }
- if (EOFreader(V)) V->allDone = true;
- }
- }
-
-
- Local boolean endNBRF( boolean *addend, boolean *ungetend, struct ReadSeqVars *V)
- {
- char *a;
-
- if ((a = strchr(V->s, '*')) != NULL) { /* end of 1st seq */
- /* "*" can be valid base symbol, drop it here */
- *a = 0;
- *addend = true;
- *ungetend= false;
- return(true);
- }
- else if (*V->s == '>') { /* start of next seq */
- *addend = false;
- *ungetend= true;
- return(true);
- }
- else
- return(false);
- }
-
- Local void readNBRF(struct ReadSeqVars *V)
- {
- while (!V->allDone) {
- strcpy(V->seqid, (V->s)+4);
- getline(V); /*skip title-junk line*/
- readLoop(0, false, endNBRF, V);
- if (!V->allDone) {
- while (!(EOFreader(V) || (*V->s != 0 && *V->s == '>')))
- getline(V);
- }
- if (EOFreader(V)) V->allDone = true;
- }
- }
-
-
-
- Local boolean endPearson( boolean *addend, boolean *ungetend, struct ReadSeqVars *V)
- {
- *addend = false;
- *ungetend= true;
- return(*V->s == '>');
- }
-
- Local void readPearson(struct ReadSeqVars *V)
- {
- while (!V->allDone) {
- strcpy(V->seqid, (V->s)+1);
- readLoop(0, false, endPearson, V);
- if (!V->allDone) {
- while (!(EOFreader(V) || ((*V->s != 0) && (*V->s == '>'))))
- getline(V);
- }
- if (EOFreader(V)) V->allDone = true;
- }
- }
-
-
-
- Local boolean endEMBL( boolean *addend, boolean *ungetend, struct ReadSeqVars *V)
- {
- *addend = false;
- *ungetend= (strstr(V->s,"ID ") == V->s);
- return ((strstr(V->s,"//") != NULL) || *ungetend);
- }
-
- Local void readEMBL(struct ReadSeqVars *V)
- {
- while (!V->allDone) {
- strcpy(V->seqid, (V->s)+5);
- do {
- getline(V);
- } while (!(EOFreader(V) || (strstr(V->s,"SQ ") == V->s)));
-
- readLoop(0, false, endEMBL, V);
- if (!V->allDone) {
- while (!(EOFreader(V) ||
- ((*V->s != '\0') && (strstr(V->s,"ID ") == V->s))))
- getline(V);
- }
- if (EOFreader(V)) V->allDone = true;
- }
- }
-
-
-
- Local boolean endZuker( boolean *addend, boolean *ungetend, struct ReadSeqVars *V)
- {
- *addend = false;
- *ungetend= true;
- return( *V->s == '(' );
- }
-
- Local void readZuker(struct ReadSeqVars *V)
- {
- /*! 1st string is Zuker's Fortran format */
-
- while (!V->allDone) {
- getline(V); /*s == "seqLen seqid string..."*/
- strcpy(V->seqid, (V->s)+6);
- readLoop(0, false, endZuker, V);
- if (!V->allDone) {
- while (!(EOFreader(V) |
- ((*V->s != '\0') && (*V->s == '('))))
- getline(V);
- }
- if (EOFreader(V)) V->allDone = true;
- }
- }
-
-
-
- Local boolean endFitch( boolean *addend, boolean *ungetend, struct ReadSeqVars *V)
- {
- /* this is a somewhat shaky end,
- 1st char of line is non-blank for seq. title
- */
- *addend = false;
- *ungetend= true;
- return( *V->s != ' ' );
- }
-
- Local void readFitch(struct ReadSeqVars *V)
- {
- boolean first;
-
- first = true;
- while (!V->allDone) {
- if (!first) strcpy(V->seqid, V->s);
- readLoop(0, first, endFitch, V);
- if (EOFreader(V)) V->allDone = true;
- first = false;
- }
- }
-
-
- Local void readPlain(struct ReadSeqVars *V)
- {
- V->nseq++;
- V->addit = (V->choice > 0);
- if (V->addit) V->seqlen = 0;
- addseq(V->seqid, V); /*from above..*/
- if (V->fname!=NULL) sprintf(V->seqid, "%s [Unknown form]", V->fname);
- else sprintf(V->seqid, " [Unknown form]");
- do {
- addseq(V->s, V);
- V->done = EOFreader(V);
- getline(V);
- } while (!V->done);
- if (V->choice == kListSequences) addinfo(V->seqid, V);
- V->allDone = true;
- }
-
-
- Local void readUWGCG(struct ReadSeqVars *V)
- {
- /*
- 10nov91: Reading GCG files casued duplication of last line when
- EOF followed that line !!!
- fix: getline now sets *V->s = 0
- */
- char *si;
-
- V->nseq++;
- V->addit = (V->choice > 0);
- if (V->addit) V->seqlen = 0;
- strcpy(V->seqid, V->s);
- /*writeseq: " %s Length: %d (today) Check: %d ..\n" */
- /*drop above or ".." from id*/
- if ((si = strstr(V->seqid," Length: ")) != 0) *si = 0;
- else if ((si = strstr(V->seqid,"..")) != 0) *si = 0;
- do {
- V->done = EOFreader(V);
- getline(V);
- if (!V->done) addseq((V->s), V);
- } while (!V->done);
- if (V->choice == kListSequences) addinfo(V->seqid, V);
- V->allDone = true;
- }
-
-
- Local void readOlsen(struct ReadSeqVars *V)
- { /* G. Olsen /print output from multiple sequence editor */
-
- char *si, *sj, *sk, *sm, sid[40], snum[20];
- boolean indata = false;
- short snumlen = 0;
-
- V->addit = (V->choice > 0);
- if (V->addit) V->seqlen = 0;
- REWINDreader(V);
- V->nseq= 0;
- do {
- getline(V);
- V->done = EOFreader(V);
-
- if (V->done && !(*V->s)) break;
- else if (indata) {
- if ( (si= strstr(V->s, sid))
- && ( (sm= strstr(V->s, snum)) != NULL ) && (sm < si - snumlen) ) {
- /* && (strstr(V->s, snum) == si - snumlen - 1) ) */
-
- /* Spaces are valid alignment data !! */
- /* 17Oct91: Error, the left margin is 21 not 22! */
- /* dropped some nucs up to now -- my example file was right shifted ! */
- /* variable right id margin, drop id-2 spaces at end */
- /*
- VMS CC COMPILER (VAXC031) mess up:
- -- Index of 21 is chopping 1st nuc on VMS systems Only!
- Byte-for-byte same ame rnasep.olsen sequence file !
- */
-
- /* si = (V->s)+21; < was this before VMS CC wasted my time */
- si += 10; /* use strstr index plus offset to outfox VMS CC bug */
-
- if ((sk = strstr(si, sid))!=0) *(sk-2) = 0;
- for (sk = si; *sk != 0; sk++) {
- if (*sk == ' ') *sk = '.';
- /* 18aug92: !! some olsen masks are NUMBERS !! which addseq eats */
- else if (isdigit(*sk)) *sk= nonummask[*sk - '0'];
- }
-
- addseq(si, V);
- }
- }
-
- else if ((sk = strstr(V->s, "): "))!=0) { /* seq info header line */
- /* 18aug92: correct for diff seqs w/ same name -- use number, e.g. */
- /* 3 (Agr.tume): agrobacterium.prna 18-JUN-1987 16:12 */
- /* 328 (Agr.tume): agrobacterium.prna XYZ 19-DEC-1992 */
- (V->nseq)++;
- si = 1 + strchr(V->s,'(');
- *sk = ' ';
- if (V->choice == kListSequences) addinfo( si, V);
- else if (V->nseq == V->choice) {
- strcpy(V->seqid, si);
- sj = strchr(V->seqid, ':');
- while (*(--sj) == ' ') ;
- while (--sj != V->seqid) { if (*sj == ' ') *sj = '_'; }
-
- *sk = 0;
- while (*(--sk) == ' ') *sk = 0;
- strcpy(sid, si);
-
- si= V->s;
- while ((*si <= ' ') && (*si != 0)) si++;
- snumlen=0;
- while (si[snumlen] > ' ' && snumlen<20)
- { snum[snumlen]= si[snumlen]; snumlen++; }
- snum[snumlen]= 0;
- }
-
- }
-
- else if (strstr(V->s,"identity: Data:")) {
- indata = true;
- if (V->choice == kListSequences) V->done = true;
- }
-
- } while (!V->done);
-
- V->allDone = true;
- } /*readOlsen*/
-
-
- Local void readMSF(struct ReadSeqVars *V)
- { /* gcg's MSF, mult. sequence format, interleaved ! */
-
- char *si, *sj, sid[128];
- boolean indata = false;
- int atseq= 0, iline= 0;
-
- V->addit = (V->choice > 0);
- if (V->addit) V->seqlen = 0;
- REWINDreader(V);
- V->nseq= 0;
- do {
- getline(V);
- V->done = EOFreader(V);
-
- if (V->done && !(*V->s)) break;
- else if (indata) {
- /*somename ...gpvedai .......t.. aaigr..vad tvgtgptnse aipaltaaet */
- /* E gvenae.kgv tentna.tad fvaqpvylpe .nqt...... kv.affynrs */
-
- si= V->s;
- skipwhitespace(si);
- /* for (sj= si; isalnum(*sj); sj++) ; bug -- delwiche uses "-", "_" and others in names*/
- for (sj= si; *sj > ' '; sj++) ;
- *sj= 0;
- if ( *si ) {
- if ( (0==strcmp(si, sid)) ) {
- addseq(sj+1, V);
- }
- iline++;
- }
- }
-
- else if (NULL != (si = strstr(V->s, "Name: "))) { /* seq info header line */
- /* Name: somename Len: 100 Check: 7009 Weight: 1.00 */
-
- (V->nseq)++;
- si += 6;
- if (V->choice == kListSequences) addinfo( si, V);
- else if (V->nseq == V->choice) {
- strcpy(V->seqid, si);
- si = V->seqid;
- skipwhitespace(si);
- /* for (sj= si; isalnum(*sj); sj++) ; -- bug */
- for (sj= si; *sj > ' '; sj++) ;
- *sj= 0;
- strcpy(sid, si);
- }
- }
-
- else if ( strstr(V->s,"//") /*== V->s*/ ) {
- indata = true;
- iline= 0;
- if (V->choice == kListSequences) V->done = true;
- }
-
- } while (!V->done);
-
-
- V->allDone = true;
- } /*readMSF*/
-
-
-
- Local void readPAUPinterleaved(struct ReadSeqVars *V)
- { /* PAUP mult. sequence format, interleaved or sequential! */
-
- char *si, *sj, *send, sid[40], sid1[40], saveseq[255];
- boolean first = true, indata = false, domatch;
- int atseq= 0, iline= 0, ifmc, saveseqlen=0;
-
- #define fixmatchchar(s) { \
- for (ifmc=0; ifmc<saveseqlen; ifmc++) \
- if (s[ifmc] == V->matchchar) s[ifmc]= saveseq[ifmc]; }
-
- V->addit = (V->choice > 0);
- V->seqlencount = 0;
- if (V->addit) V->seqlen = 0;
- /* rewind(V->f); V->nseq= 0; << do in caller !*/
- indata= true; /* call here after we find "matrix" */
- domatch= (V->matchchar > 0);
-
- do {
- getline(V);
- V->done = EOFreader(V);
-
- if (V->done && !(*V->s)) break;
- else if (indata) {
- /* [ 1 1 1 ]*/
- /* human aagcttcaccggcgcagtca ttctcataatcgcccacggR cttacatcct*/
- /* chimp ................a.t. .c.................a ..........*/
- /* !! need to correct for V->matchchar */
- si= V->s;
- skipwhitespace(si);
- if (strchr(si,';')) indata= false;
-
- if (isalnum(*si)) {
- /* valid data line starts w/ a left-justified seq name in columns [0..8] */
- if (first) {
- (V->nseq)++;
- if (V->nseq >= V->topnseq) first= false;
- for (sj = si; isalnum(*sj); sj++) ;
- send= sj;
- skipwhitespace(sj);
- if (V->choice == kListSequences) {
- *send= 0;
- addinfo( si, V);
- }
- else if (V->nseq == V->choice) {
- if (domatch) {
- if (V->nseq == 1) { strcpy( saveseq, sj); saveseqlen= strlen(saveseq); }
- else fixmatchchar( sj);
- }
- addseq(sj, V);
- *send= 0;
- strcpy(V->seqid, si);
- strcpy(sid, si);
- if (V->nseq == 1) strcpy(sid1, sid);
- }
- }
-
- else if ( (strstr(si, sid) == si) ){
- while (isalnum(*si)) si++;
- skipwhitespace(si);
- if (domatch) {
- if (V->nseq == 1) { strcpy( saveseq, si); saveseqlen= strlen(saveseq); }
- else fixmatchchar( si);
- }
- addseq(si, V);
- }
-
- else if (domatch && (strstr(si, sid1) == si)) {
- strcpy( saveseq, si);
- saveseqlen= strlen(saveseq);
- }
-
- iline++;
- }
- }
-
- else if ( strstr(V->s,"matrix") ) {
- indata = true;
- iline= 0;
- if (V->choice == kListSequences) V->done = true;
- }
-
- } while (!V->done);
-
- V->allDone = true;
- } /*readPAUPinterleaved*/
-
-
-
- Local void readPAUPsequential(struct ReadSeqVars *V)
- { /* PAUP mult. sequence format, interleaved or sequential! */
- char *si, *sj;
- boolean atname = true, indata = false;
-
- V->addit = (V->choice > 0);
- if (V->addit) V->seqlen = 0;
- V->seqlencount = 0;
- /* REWINDreader(V); V->nseq= 0; << do in caller !*/
- indata= true; /* call here after we find "matrix" */
- do {
- getline(V);
- V->done = EOFreader(V);
-
- if (V->done && !(*V->s)) break;
- else if (indata) {
- /* [ 1 1 1 ]*/
- /* human aagcttcaccggcgcagtca ttctcataatcgcccacggR cttacatcct*/
- /* aagcttcaccggcgcagtca ttctcataatcgcccacggR cttacatcct*/
- /* chimp ................a.t. .c.................a ..........*/
- /* ................a.t. .c.................a ..........*/
-
- si= V->s;
- skipwhitespace(si);
- if (strchr(si,';')) indata= false;
- if (isalnum(*si)) {
- /* valid data line starts w/ a left-justified seq name in columns [0..8] */
- if (atname) {
- (V->nseq)++;
- V->seqlencount = 0;
- atname= false;
- sj= si+1;
- while (isalnum(*sj)) sj++;
- if (V->choice == kListSequences) {
- /* !! we must count bases to know when topseqlen is reached ! */
- countseq(sj, V);
- if (V->seqlencount >= V->topseqlen) atname= true;
- *sj= 0;
- addinfo( si, V);
- }
- else if (V->nseq == V->choice) {
- addseq(sj, V);
- V->seqlencount= V->seqlen;
- if (V->seqlencount >= V->topseqlen) atname= true;
- *sj= 0;
- strcpy(V->seqid, si);
- }
- else {
- countseq(sj, V);
- if (V->seqlencount >= V->topseqlen) atname= true;
- }
- }
-
- else if (V->nseq == V->choice) {
- addseq(V->s, V);
- V->seqlencount= V->seqlen;
- if (V->seqlencount >= V->topseqlen) atname= true;
- }
- else {
- countseq(V->s, V);
- if (V->seqlencount >= V->topseqlen) atname= true;
- }
- }
- }
-
- else if ( strstr(V->s,"matrix") ) {
- indata = true;
- atname= true;
- if (V->choice == kListSequences) V->done = true;
- }
-
- } while (!V->done);
-
- V->allDone = true;
- } /*readPAUPsequential*/
-
-
- Local void readPhylipInterleaved(struct ReadSeqVars *V)
- {
- char *si, *sj;
- boolean first = true;
- int iline= 0;
-
- V->addit = (V->choice > 0);
- if (V->addit) V->seqlen = 0;
- V->seqlencount = 0;
- /* sscanf( V->s, "%d%d", &V->topnseq, &V->topseqlen); << topnseq == 0 !!! bad scan !! */
- si= V->s;
- skipwhitespace(si);
- V->topnseq= atoi(si);
- while (isdigit(*si)) si++;
- skipwhitespace(si);
- V->topseqlen= atol(si);
- /* fprintf(stderr,"Phylip-ileaf: topnseq=%d topseqlen=%d\n",V->topnseq, V->topseqlen); */
-
- do {
- getline(V);
- V->done = EOFreader(V);
-
- if (V->done && !(*V->s)) break;
- si= V->s;
- skipwhitespace(si);
- if (*si != 0) {
-
- if (first) { /* collect seq names + seq, as fprintf(outf,"%-10s ",seqname); */
- (V->nseq)++;
- if (V->nseq >= V->topnseq) first= false;
- sj= V->s+10; /* past name, start of data */
- if (V->choice == kListSequences) {
- *sj= 0;
- addinfo( si, V);
- }
- else if (V->nseq == V->choice) {
- addseq(sj, V);
- *sj= 0;
- strcpy(V->seqid, si);
- }
- }
- else if ( iline % V->nseq == V->choice -1 ) {
- addseq(si, V);
- }
- iline++;
- }
- } while (!V->done);
-
- V->allDone = true;
- } /*readPhylipInterleaved*/
-
-
-
- Local boolean endPhylipSequential( boolean *addend, boolean *ungetend, struct ReadSeqVars *V)
- {
- boolean done;
- /* *addend = false; << need this true if EOF(file) on last dataline */
- *ungetend= false;
- countseq( V->s, V);
- done= (V->seqlencount >= V->topseqlen);
- *addend = !done;
- return done;
- }
-
- Local void readPhylipSequential(struct ReadSeqVars *V)
- {
- short i;
- char *si;
- /* sscanf( V->s, "%d%d", &V->topnseq, &V->topseqlen); < ? bad sscan ? */
- si= V->s;
- skipwhitespace(si);
- V->topnseq= atoi(si);
- while (isdigit(*si)) si++;
- skipwhitespace(si);
- V->topseqlen= atol(si);
- getline(V);
- while (!V->allDone) {
- V->seqlencount= 0;
- strncpy(V->seqid, (V->s), 10);
- V->seqid[10]= 0;
- for (i=0; i<10 && V->s[i]; i++) V->s[i]= ' ';
- readLoop(0, true, endPhylipSequential, V);
- if (EOFreader(V)) V->allDone = true;
- }
- }
-
-
-
-
- Local void readSeqMain(
- struct ReadSeqVars *V,
- const long skiplines,
- const short format)
- {
- #define tolowerstr(s) { long Itlwr, Ntlwr= strlen(s); \
- for (Itlwr=0; Itlwr<Ntlwr; Itlwr++) s[Itlwr]= to_lower(s[Itlwr]); }
-
- boolean gotuw;
- long l;
-
- /*fprintf(stderr,"readSeqMain &reader= %ld &gFile= %ld\n", V->reader, gFile);*/
-
- V->linestart= 0;
- V->matchchar= 0;
- if (V->reader == NULL)
- V->err = eFileNotFound;
- else {
-
- for (l = skiplines; l > 0; l--) getline( V);
-
- do {
- getline( V);
- for (l= strlen(V->s); (l > 0) && (V->s[l] == ' '); l--) ;
- } while ((l == 0) && !EOFreader(V));
-
- if (EOFreader(V)) V->err = eNoData;
-
- else switch (format) {
- case kPlain : readPlain(V); break;
- case kIG : readIG(V); break;
- case kStrider: readStrider(V); break;
- case kGenBank: readGenBank(V); break;
- case kPIR : readPIR(V); break;
- case kNBRF : readNBRF(V); break;
- case kPearson: readPearson(V); break;
- case kEMBL : readEMBL(V); break;
- case kZuker : readZuker(V); break;
- case kOlsen : readOlsen(V); break;
- case kMSF :
- V->isseqchar = isGCGSeqChar;
- readMSF(V);
- break;
-
- case kPAUP : {
- boolean done= false;
- boolean interleaved= false;
- char *cp;
- /* REWINDreader(V); V->nseq= 0; ?? assume it is at top ?? skiplines ... */
- while (!done) {
- getline( V);
- tolowerstr( V->s);
- if (strstr( V->s, "matrix")) done= true;
- if (strstr( V->s, "interleav")) interleaved= true;
- if (NULL != (cp=strstr( V->s, "ntax=")) ) V->topnseq= atoi(cp+5);
- if (NULL != (cp=strstr( V->s, "nchar=")) ) V->topseqlen= atoi(cp+6);
- if (NULL != (cp=strstr( V->s, "matchchar=")) ) {
- cp += 10;
- if (*cp=='\'') cp++;
- else if (*cp=='"') cp++;
- V->matchchar= *cp;
- }
- }
- if (interleaved) readPAUPinterleaved(V);
- else readPAUPsequential(V);
- }
- break;
-
- /* kPhylip: ! can't determine in middle of file which type it is...*/
- /* test for interleave or sequential and use Phylip4(ileave) or Phylip2 */
- case kPhylip2:
- readPhylipSequential(V);
- break;
- case kPhylip4: /* == kPhylip3 */
- readPhylipInterleaved(V);
- break;
-
- default:
- V->err = eUnknownFormat;
- break;
-
- case kFitch :
- strcpy(V->seqid, V->s); getline(V);
- readFitch(V);
- break;
-
- case kGCG:
- V->isseqchar = isGCGSeqChar;
- do {
- gotuw = (strstr(V->s,"..") != NULL);
- if (gotuw) readUWGCG(V);
- getline(V);
- } while (!(EOFreader(V) || V->allDone));
- break;
- }
- }
-
- V->filestart= false;
- V->seq[V->seqlen] = 0; /* stick a string terminator on it */
- }
-
-
- char *readSeqFp(
- const short whichEntry, /* index to sequence in file */
- FILE *fp, /* pointer to open seq file */
- const long skiplines,
- const short format, /* sequence file format */
- long *seqlen, /* return seq size */
- short *nseq, /* number of seqs in file, for listSeqs() */
- short *error, /* return error */
- char *seqid) /* return seq name/info */
- {
- struct ReadSeqVars V;
-
- gFile= fp; gLinestart = 0;
- V.reader = readWriteFromFile;
-
- if (format < kMinFormat || format > kMaxFormat) {
- *error = eUnknownFormat;
- *seqlen = 0;
- return NULL;
- }
-
- V.choice = whichEntry;
- V.fname = NULL; /* don't know */
- V.seq = (char*) MALLOC(kStartLength+1);
- V.maxseq = kStartLength;
- V.seqlen = 0;
- V.seqid = seqid;
-
- V.f = fp;
- V.filestart= (ftell( fp) == 0);
- /* !! in sequential read, must remove current seq position from choice/whichEntry counter !! ... */
- if (V.filestart) V.nseq = 0;
- else V.nseq= *nseq; /* track where we are in file...*/
-
- *V.seqid = '\0';
- V.err = 0;
- V.nseq = 0;
- V.isseqchar = isSeqChar;
- if (V.choice == kListSequences) ; /* leave as is */
- else if (V.choice <= 0) V.choice = 1; /* default ?? */
- V.addit = (V.choice > 0);
- V.allDone = false;
-
- readSeqMain(&V, skiplines, format);
-
- *error = V.err;
- *seqlen = V.seqlen;
- *nseq = V.nseq;
- return V.seq;
- }
-
- char *readSeq(
- const short whichEntry, /* index to sequence in file */
- const char *filename, /* file name */
- const long skiplines,
- const short format, /* sequence file format */
- long *seqlen, /* return seq size */
- short *nseq, /* number of seqs in file, for listSeqs() */
- short *error, /* return error */
- char *seqid) /* return seq name/info */
- {
- struct ReadSeqVars V;
-
- if (format < kMinFormat || format > kMaxFormat) {
- *error = eUnknownFormat;
- *seqlen = 0;
- return NULL;
- }
-
- V.choice = whichEntry;
- V.fname = filename; /* don't need to copy string, just ptr to it */
- V.seq = (char*) MALLOC( kStartLength+1);
- V.maxseq = kStartLength;
- V.seqlen = 0;
- V.seqid = seqid;
-
- V.f = NULL;
- *V.seqid = '\0';
- V.err = 0;
- V.nseq = 0;
- V.isseqchar = isSeqChar;
- if (V.choice == kListSequences) ; /* leave as is */
- else if (V.choice <= 0) V.choice = 1; /* default ?? */
- V.addit = (V.choice > 0);
- V.allDone = false;
-
- V.f = fopen(V.fname, "r");
- V.filestart= true;
- gFile= V.f; gLinestart = 0;
- V.reader = readWriteFromFile;
-
- readSeqMain(&V, skiplines, format);
-
- if (V.f != NULL) fclose(V.f);
- *error = V.err;
- *seqlen = V.seqlen;
- *nseq = V.nseq;
- return V.seq;
- }
-
-
-
- char *readSeqCall(
- const short whichEntry, /* index to sequence in file */
- ReadWriteProc reader,
- const long skiplines,
- const short format, /* sequence file format */
- long *seqlen, /* return seq size */
- short *nseq, /* number of seqs in file, for listSeqs() */
- short *error, /* return error */
- char *seqid) /* return seq name/info */
- {
- struct ReadSeqVars V;
-
- if (format < kMinFormat || format > kMaxFormat) {
- *error = eUnknownFormat;
- *seqlen = 0;
- return NULL;
- }
-
- V.choice = whichEntry;
- V.fname = NULL; /* don't know */
- V.seq = (char*) MALLOC( kStartLength+1);
- V.maxseq = kStartLength;
- V.seqlen = 0;
- V.seqid = seqid;
- *V.seqid = '\0';
-
- V.f = NULL;
- V.err = 0;
- V.nseq = 0;
- V.isseqchar = isSeqChar;
- if (V.choice == kListSequences) ; /* leave as is */
- else if (V.choice <= 0) V.choice = 1; /* default ?? */
- V.addit = (V.choice > 0);
- V.allDone = false;
-
- gFile= NULL; gLinestart = 0;
- V.reader = reader;
- V.filestart= (0 == (*reader)((char*)NULL, 0L, kRSFile_Tell));
-
- readSeqMain(&V, skiplines, format);
-
- *error = V.err;
- *seqlen = V.seqlen;
- *nseq = V.nseq;
- return V.seq;
- }
-
-
-
- char *listSeqs(
- const char *filename, /* file name */
- const long skiplines,
- const short format, /* sequence file format */
- short *nseq, /* number of seqs in file, for listSeqs() */
- short *error) /* return error */
- {
- char seqid[256];
- long seqlen;
-
- /*fprintf(stderr,"listSeqs filename= %s format= %d nseq= %d\n", filename, format, *nseq);*/
- return readSeq( kListSequences, filename, skiplines, format,
- &seqlen, nseq, error, seqid);
- }
-
- char *listSeqsCall(
- ReadWriteProc reader,
- const long skiplines,
- const short format, /* sequence file format */
- short *nseq, /* number of seqs in file, for listSeqs() */
- short *error) /* return error */
- {
- char seqid[256];
- long seqlen;
-
- return readSeqCall( kListSequences, reader, skiplines, format,
- &seqlen, nseq, error, seqid);
- }
-
-
-
-
- short seqFileFormat( /* return sequence format number, see ureadseq.h */
- const char *filename,
- long *skiplines, /* return #lines to skip any junk like mail header */
- short *error) /* return any error value or 0 */
- {
- FILE *fseq;
- short format;
-
- fseq = fopen(filename, "r");
- format= seqFileFormatFp( fseq, skiplines, error);
- if (fseq!=NULL) fclose(fseq);
- return format;
- }
-
- short seqFileFormatFp(
- FILE *fseq,
- long *skiplines, /* return #lines to skip any junk like mail header */
- short *error) /* return any error value or 0 */
- {
- gFile = fseq; gLinestart = 0;
- return seqFileFormatCall( readWriteFromFile, skiplines, error);
- }
-
-
-
- short seqFileFormatCall(
- ReadWriteProc reader,
- long *skiplines, /* return #lines to skip any junk like mail header */
- short *error) /* return any error value or 0 */
- {
- boolean foundDNA= false, foundIG= false, foundStrider= false,
- foundGB= false, foundPIR= false, foundEMBL= false, foundNBRF= false,
- foundPearson= false, foundFitch= false, foundPhylip= false, foundZuker= false,
- gotolsen= false, gotpaup = false, gotasn1 = false, gotuw= false, gotMSF= false,
- isfitch= false, isphylip= false, done= false;
- short format= kUnknown;
- int nlines= 0, k, splen= 0, otherlines= 0, aminolines= 0, dnalines= 0;
- char sp[256];
- long linestart=0;
- int maxlines2check=500;
-
- #define ReadOneLine(sp) \
- { done |= (boolean)((*reader)((char*)NULL, 0L, kRSFile_Eof)); \
- callreadline( reader, sp); \
- if (!done) { splen = strlen(sp); ++nlines; } }
-
- /* { done |= feof(fp); \ */
- /* readline( fp, sp, &linestart); \ */
-
- /*fprintf(stderr,"seqFileFormatCall &reader= %ld &gFile= %ld\n", reader, gFile); */
-
- *skiplines = 0;
- *error = 0;
- if (reader == NULL) { *error = eFileNotFound; return kNoformat; }
-
- while ( !done ) {
- ReadOneLine(sp);
-
- /* check for mailer head & skip past if found */
- if (nlines < 4 && !done) {
- if ((strstr(sp,"From ") == sp) || (strstr(sp,"Received:") == sp)) {
- do {
- /* skip all lines until find one blank line */
- ReadOneLine(sp);
- if (!done) for (k=0; (k<splen) && (sp[k]==' '); k++) ;
- } while ((!done) && (k < splen));
- *skiplines = nlines; /* !? do we want #lines or #bytes ?? */
- }
- }
-
- if (sp==NULL || *sp==0)
- ; /* nada */
-
- /* high probability identities: */
-
- else if ( strstr(sp,"MSF:") && strstr(sp,"Type:") && strstr(sp,"Check:") )
- gotMSF= true;
-
- else if ((strstr(sp,"..") != NULL) && (strstr(sp,"Check:") != NULL))
- gotuw= true;
-
- else if (strstr(sp,"identity: Data:") != NULL)
- gotolsen= true;
-
- else if ( strstr(sp,"::=") &&
- (strstr(sp,"Bioseq") || /* Bioseq or Bioseq-set */
- strstr(sp,"Seq-entry") ||
- strstr(sp,"Seq-submit") ) ) /* can we read submit format? */
- gotasn1= true;
-
- else if ( strstr(sp,"#NEXUS") == sp )
- gotpaup= true;
-
- /* uncertain identities: */
-
- else if (*sp ==';') {
- if (strstr(sp,"Strider") !=NULL) foundStrider= true;
- else foundIG= true;
- }
-
- else if (strstr(sp,"LOCUS") == sp)
- foundGB= true;
- else if (strstr(sp,"ORIGIN") == sp)
- foundGB= true;
-
- else if (strstr(sp,"ENTRY ") == sp) /* ? also (strcmp(sp,"\\\\\\")==0) */
- foundPIR= true;
- else if (strstr(sp,"SEQUENCE") == sp)
- foundPIR= true;
-
- else if (*sp == '>') {
- if (sp[3] == ';') foundNBRF= true;
- else foundPearson= true;
- }
-
- else if (strstr(sp,"ID ") == sp)
- foundEMBL= true;
- else if (strstr(sp,"SQ ") == sp)
- foundEMBL= true;
-
- else if (*sp == '(')
- foundZuker= true;
-
- else {
- if (nlines - *skiplines == 1) {
- int ispp= 0, ilen= 0;
- sscanf( sp, "%d%d", &ispp, &ilen);
- if (ispp > 0 && ilen > 0) isphylip= true;
- }
- else if (isphylip && nlines - *skiplines == 2) {
- int tseq;
- tseq= getseqtype(sp+10, strlen(sp+10));
- if ( isalpha(*sp) /* 1st letter in 2nd line must be of a name */
- && (tseq != kOtherSeq)) /* sequence section must be okay */
- foundPhylip= true;
- }
-
- for (k=0, isfitch= true; isfitch && (k < splen); k++) {
- if (k % 4 == 0) isfitch &= (sp[k] == ' ');
- else isfitch &= (sp[k] != ' ');
- }
- if (isfitch && (splen > 20)) foundFitch= true;
-
- /* kRNA && kDNA are fairly certain...*/
- switch (getseqtype( sp, splen)) {
- case kOtherSeq: otherlines++; break;
- case kAmino : if (splen>20) aminolines++; break;
- case kDNA :
- case kRNA : if (splen>20) dnalines++; break;
- case kNucleic : break; /* not much info ? */
- }
-
- }
-
- /* pretty certain */
- if (gotolsen) {
- format= kOlsen;
- done= true;
- }
- else if (gotMSF) {
- format= kMSF;
- done= true;
- }
- else if (gotasn1) {
- /* !! we need to look further and return kASNseqentry | kASNseqset */
- /*
- seqentry key is Seq-entry ::=
- seqset key is Bioseq-set ::=
- ?? can't read these yet w/ ncbi tools ??
- Seq-submit ::=
- Bioseq ::= << fails both bioseq-seq and seq-entry parsers !
- */
- if (strstr(sp,"Bioseq-set")) format= kASNseqset;
- else if (strstr(sp,"Seq-entry")) format= kASNseqentry;
- else format= kASN1; /* other form, we can't yet read... */
- done= true;
- }
- else if (gotpaup) {
- format= kPAUP;
- done= true;
- }
-
- else if (gotuw) {
- if (foundIG) format= kIG; /* a TOIG file from GCG for certain */
- else format= kGCG;
- done= true;
- }
-
- else if ((dnalines > 1) || done || (nlines > maxlines2check)) {
- /* decide on most likely format */
- /* multichar idents: */
- if (foundStrider) format= kStrider;
- else if (foundGB) format= kGenBank;
- else if (foundPIR) format= kPIR;
- else if (foundEMBL) format= kEMBL;
- else if (foundNBRF) format= kNBRF;
- /* single char idents: */
- else if (foundIG) format= kIG;
- else if (foundPearson) format= kPearson;
- else if (foundZuker) format= kZuker;
- /* digit ident: */
- else if (foundPhylip) format= kPhylip;
- /* spacing ident: */
- else if (foundFitch) format= kFitch;
- /* no format chars: */
- else if (otherlines > 0) format= kUnknown;
- else if (dnalines > 1) format= kPlain;
- else if (aminolines > 1) format= kPlain;
- else format= kUnknown;
-
- done= true;
- }
-
- /* need this for possible long header in olsen format */
- else if (strstr(sp,"): ") != NULL)
- maxlines2check++;
- }
-
- if (format == kPhylip) {
- /* check for interleaved or sequential -- really messy */
- int tname, tseq;
- long i, j, nspp= 0, nlen= 0, ilen, leaf= 0, seq= 0;
- char *ps;
-
- (void) (*reader)((char*)NULL, 0L, kRSFile_Rewind);
- /*rewind(fp);*/
- for (i=0; i < *skiplines; i++) ReadOneLine(sp);
- nlines= 0;
- ReadOneLine(sp);
- sscanf( sp, "%d%d", &nspp, &nlen);
- ReadOneLine(sp); /* 1st seq line */
- for (ps= sp+10, ilen=0; *ps!=0; ps++) if (isprint(*ps)) ilen++;
-
- for (i= 1; i<nspp; i++) {
- ReadOneLine(sp);
-
- tseq= getseqtype(sp+10, strlen(sp+10));
- tname= getseqtype(sp, 10);
- for (j=0, ps= sp; isspace(*ps) && j<10; ps++, j++) ;
- for (ps= sp; *ps!=0; ps++) if (isprint(*ps)) ilen++;
-
- /* find probable interleaf or sequential ... */
- if (j>=9) seq += 10; /* pretty certain not ileaf */
- else {
- if (tseq != tname) leaf++; else seq++;
- if (tname == kDNA || tname == kRNA) seq++; else leaf++;
- }
-
- if (ilen <= nlen && j<9) {
- if (tname == kOtherSeq) leaf += 10;
- else if (tname == kAmino || tname == kDNA || tname == kRNA) seq++; else leaf++;
- }
- else if (ilen > nlen) {
- ilen= 0;
- }
- }
- for ( nspp *= 2 ; i<nspp; i++) { /* this should be only bases if interleaf */
- ReadOneLine(sp);
-
- tseq= getseqtype(sp+10, strlen(sp+10));
- tname= getseqtype(sp, 10);
- for (ps= sp; *ps!=0; ps++) if (isprint(*ps)) ilen++;
- for (j=0, ps= sp; isspace(*ps) && j<10; ps++, j++) ;
- if (j<9) {
- if (tname == kOtherSeq) seq += 10;
- if (tseq != tname) seq++; else leaf++;
- if (tname == kDNA || tname == kRNA) leaf++; else seq++;
- }
- if (ilen > nlen) {
- if (j>9) leaf += 10; /* must be a name here for sequent */
- else if (tname == kOtherSeq) seq += 10;
- ilen= 0;
- }
- }
-
- if (leaf > seq) format= kPhylip4;
- else format= kPhylip2;
- }
-
- /*fprintf(stderr, "seqFileFormatCall &reader= %ld &gFile= %ld format= %ld\n", reader, gFile, format);*/
- return(format);
- #undef ReadOneLine
- } /* SeqFileFormat */
-
-
-
-
- unsigned long GCGchecksum( const char *seq, const long seqlen, unsigned long *checktotal)
- /* GCGchecksum */
- {
- register long i, check = 0, count = 0;
- register char *sp = (char*) seq;
-
- for (i = 0; i < seqlen; i++) {
- count++;
- check += count * to_upper(*sp);
- sp++;
- if (count == 57) count = 0;
- }
- check %= 10000;
- *checktotal += check;
- *checktotal %= 10000;
- return check;
- }
-
- /* Table of CRC-32's of all single byte values (made by makecrc.c of ZIP source) */
- const unsigned long crctab[] = {
- 0x00000000L, 0x77073096L, 0xee0e612cL, 0x990951baL, 0x076dc419L,
- 0x706af48fL, 0xe963a535L, 0x9e6495a3L, 0x0edb8832L, 0x79dcb8a4L,
- 0xe0d5e91eL, 0x97d2d988L, 0x09b64c2bL, 0x7eb17cbdL, 0xe7b82d07L,
- 0x90bf1d91L, 0x1db71064L, 0x6ab020f2L, 0xf3b97148L, 0x84be41deL,
- 0x1adad47dL, 0x6ddde4ebL, 0xf4d4b551L, 0x83d385c7L, 0x136c9856L,
- 0x646ba8c0L, 0xfd62f97aL, 0x8a65c9ecL, 0x14015c4fL, 0x63066cd9L,
- 0xfa0f3d63L, 0x8d080df5L, 0x3b6e20c8L, 0x4c69105eL, 0xd56041e4L,
- 0xa2677172L, 0x3c03e4d1L, 0x4b04d447L, 0xd20d85fdL, 0xa50ab56bL,
- 0x35b5a8faL, 0x42b2986cL, 0xdbbbc9d6L, 0xacbcf940L, 0x32d86ce3L,
- 0x45df5c75L, 0xdcd60dcfL, 0xabd13d59L, 0x26d930acL, 0x51de003aL,
- 0xc8d75180L, 0xbfd06116L, 0x21b4f4b5L, 0x56b3c423L, 0xcfba9599L,
- 0xb8bda50fL, 0x2802b89eL, 0x5f058808L, 0xc60cd9b2L, 0xb10be924L,
- 0x2f6f7c87L, 0x58684c11L, 0xc1611dabL, 0xb6662d3dL, 0x76dc4190L,
- 0x01db7106L, 0x98d220bcL, 0xefd5102aL, 0x71b18589L, 0x06b6b51fL,
- 0x9fbfe4a5L, 0xe8b8d433L, 0x7807c9a2L, 0x0f00f934L, 0x9609a88eL,
- 0xe10e9818L, 0x7f6a0dbbL, 0x086d3d2dL, 0x91646c97L, 0xe6635c01L,
- 0x6b6b51f4L, 0x1c6c6162L, 0x856530d8L, 0xf262004eL, 0x6c0695edL,
- 0x1b01a57bL, 0x8208f4c1L, 0xf50fc457L, 0x65b0d9c6L, 0x12b7e950L,
- 0x8bbeb8eaL, 0xfcb9887cL, 0x62dd1ddfL, 0x15da2d49L, 0x8cd37cf3L,
- 0xfbd44c65L, 0x4db26158L, 0x3ab551ceL, 0xa3bc0074L, 0xd4bb30e2L,
- 0x4adfa541L, 0x3dd895d7L, 0xa4d1c46dL, 0xd3d6f4fbL, 0x4369e96aL,
- 0x346ed9fcL, 0xad678846L, 0xda60b8d0L, 0x44042d73L, 0x33031de5L,
- 0xaa0a4c5fL, 0xdd0d7cc9L, 0x5005713cL, 0x270241aaL, 0xbe0b1010L,
- 0xc90c2086L, 0x5768b525L, 0x206f85b3L, 0xb966d409L, 0xce61e49fL,
- 0x5edef90eL, 0x29d9c998L, 0xb0d09822L, 0xc7d7a8b4L, 0x59b33d17L,
- 0x2eb40d81L, 0xb7bd5c3bL, 0xc0ba6cadL, 0xedb88320L, 0x9abfb3b6L,
- 0x03b6e20cL, 0x74b1d29aL, 0xead54739L, 0x9dd277afL, 0x04db2615L,
- 0x73dc1683L, 0xe3630b12L, 0x94643b84L, 0x0d6d6a3eL, 0x7a6a5aa8L,
- 0xe40ecf0bL, 0x9309ff9dL, 0x0a00ae27L, 0x7d079eb1L, 0xf00f9344L,
- 0x8708a3d2L, 0x1e01f268L, 0x6906c2feL, 0xf762575dL, 0x806567cbL,
- 0x196c3671L, 0x6e6b06e7L, 0xfed41b76L, 0x89d32be0L, 0x10da7a5aL,
- 0x67dd4accL, 0xf9b9df6fL, 0x8ebeeff9L, 0x17b7be43L, 0x60b08ed5L,
- 0xd6d6a3e8L, 0xa1d1937eL, 0x38d8c2c4L, 0x4fdff252L, 0xd1bb67f1L,
- 0xa6bc5767L, 0x3fb506ddL, 0x48b2364bL, 0xd80d2bdaL, 0xaf0a1b4cL,
- 0x36034af6L, 0x41047a60L, 0xdf60efc3L, 0xa867df55L, 0x316e8eefL,
- 0x4669be79L, 0xcb61b38cL, 0xbc66831aL, 0x256fd2a0L, 0x5268e236L,
- 0xcc0c7795L, 0xbb0b4703L, 0x220216b9L, 0x5505262fL, 0xc5ba3bbeL,
- 0xb2bd0b28L, 0x2bb45a92L, 0x5cb36a04L, 0xc2d7ffa7L, 0xb5d0cf31L,
- 0x2cd99e8bL, 0x5bdeae1dL, 0x9b64c2b0L, 0xec63f226L, 0x756aa39cL,
- 0x026d930aL, 0x9c0906a9L, 0xeb0e363fL, 0x72076785L, 0x05005713L,
- 0x95bf4a82L, 0xe2b87a14L, 0x7bb12baeL, 0x0cb61b38L, 0x92d28e9bL,
- 0xe5d5be0dL, 0x7cdcefb7L, 0x0bdbdf21L, 0x86d3d2d4L, 0xf1d4e242L,
- 0x68ddb3f8L, 0x1fda836eL, 0x81be16cdL, 0xf6b9265bL, 0x6fb077e1L,
- 0x18b74777L, 0x88085ae6L, 0xff0f6a70L, 0x66063bcaL, 0x11010b5cL,
- 0x8f659effL, 0xf862ae69L, 0x616bffd3L, 0x166ccf45L, 0xa00ae278L,
- 0xd70dd2eeL, 0x4e048354L, 0x3903b3c2L, 0xa7672661L, 0xd06016f7L,
- 0x4969474dL, 0x3e6e77dbL, 0xaed16a4aL, 0xd9d65adcL, 0x40df0b66L,
- 0x37d83bf0L, 0xa9bcae53L, 0xdebb9ec5L, 0x47b2cf7fL, 0x30b5ffe9L,
- 0xbdbdf21cL, 0xcabac28aL, 0x53b39330L, 0x24b4a3a6L, 0xbad03605L,
- 0xcdd70693L, 0x54de5729L, 0x23d967bfL, 0xb3667a2eL, 0xc4614ab8L,
- 0x5d681b02L, 0x2a6f2b94L, 0xb40bbe37L, 0xc30c8ea1L, 0x5a05df1bL,
- 0x2d02ef8dL
- };
-
- unsigned long CRC32checksum(const char *seq, const long seqlen, unsigned long *checktotal)
- /*CRC32checksum: modified from CRC-32 algorithm found in ZIP compression source */
- {
- register unsigned long c = 0xffffffffL;
- register long n = seqlen;
- register char *sp = (char*) seq;
-
- while (n--) {
- c = crctab[((int)c ^ (to_upper(*sp))) & 0xff] ^ (c >> 8);
- sp++;
- }
- c= c ^ 0xffffffffL;
- *checktotal += c;
- return c;
- }
-
-
-
-
- short getseqtype( const char *seq, const long seqlen)
- { /* return sequence kind: kDNA, kRNA, kProtein, kOtherSeq, ??? */
- char c;
- register char *sp = (char*) seq;
- short i, maxtest;
- short na = 0, aa = 0, po = 0, nt = 0, nu = 0, ns = 0, no = 0;
-
- maxtest = (short) min(300, seqlen);
- for (i = 0; i < maxtest; i++) {
- c = to_upper(*sp); sp++;
- if (strchr(protonly, c)) po++;
- else if (strchr(primenuc,c)) {
- na++;
- if (c == 'T') nt++;
- else if (c == 'U') nu++;
- }
- else if (strchr(aminos,c)) aa++;
- else if (strchr(seqsymbols,c)) ns++;
- else if (isalpha(c)) no++;
- }
-
- if ((no > 0) || (po+aa+na == 0)) return kOtherSeq;
- /* ?? test for probability of kOtherSeq ?, e.g.,
- else if (po+aa+na / maxtest < 0.70) return kOtherSeq;
- */
- else if (po > 0) return kAmino;
- else if (aa == 0) {
- if (nu > nt) return kRNA;
- else return kDNA;
- }
- else if (na > aa) return kNucleic;
- else return kAmino;
- } /* getseqtype */
-
-
- void GetSeqStats( const char* seq, const long seqlen,
- short* seqtype, unsigned long* checksum, long* basecount)
- {
- register unsigned long chk = 0xffffffffL;
- register long n = seqlen;
- register char c, *seqp;
- short na = 0, aa= 0, no= 0, ns= 0, nt= 0, po= 0, nu= 0;
- short seqt = kOtherSeq;
- unsigned long checks= 0;
- long basec= 0;
-
- if (seq) {
- na= aa= no= ns= nt= po= nu= 0;
- seqp= (char*) seq;
- while (n--) {
- c= to_upper(*seqp);
- seqp++;
- if (c > ' ' && (c < '0' || c > '9')) {
- chk = crctab[((int)chk ^ c) & 0xff] ^ (chk >> 8);
-
- basec++;
- if (strchr( protonly, c)) po++;
- else if (strchr(primenuc, c)) {
- na++;
- if (c == 'T') nt++;
- else if (c == 'U') nu++;
- }
- else if (strchr(aminos, c)) aa++;
- else if (strchr(seqsymbols, c)) ns++;
- else if (isalpha(c)) no++;
- }
- }
- /* checks= chk ^ 0xffffffffL; */
- if (no > 0 || po+aa+na == 0) seqt = kOtherSeq;
- else if (po > 0) seqt = kAmino;
- else if (aa == 0) {
- if (nu > nt) seqt = kRNA;
- else seqt = kDNA;
- }
- else if (na > aa) seqt = kNucleic;
- else seqt = kAmino;
- }
- if (seqtype) *seqtype= seqt;
- if (checksum) *checksum= chk ^ 0xffffffffL;
- if (basecount) *basecount= basec;
- }
-
-
- char* compressSeq( const char gapc, const char *seq, const long seqlen, long *newlen)
- {
- register char *a, *b;
- register long i;
- char *newseq;
-
- *newlen= 0;
- if (!seq) return NULL;
- newseq = (char*) MALLOC(seqlen+1);
- if (!newseq) return NULL;
- for (a= (char*)seq, b=newseq, i=0; *a!=0; a++)
- if (*a != gapc) {
- *b++= *a;
- i++;
- }
- *b= '\0';
- #ifdef NOTmacintosh
- SetPtrSize( (Ptr)newseq, i+1);
- #else
- newseq = (char*) realloc(newseq, i+1);
- #endif
- *newlen= i;
- return newseq;
- }
-
-
-
- /***
- char *rtfhead = "{\\rtf1\\defformat\\mac\\deff2 \
- {\\fonttbl\
- {\\f1\\fmodern Courier;}{\\f2\\fmodern Monaco;}\
- {\\f3\\fswiss Helvetica;}{\\f4\\fswiss Geneva;}\
- {\\f5\\froman Times;}{\\f6\\froman Palatino;}\
- {\\f7\\froman New Century Schlbk;}{\\f8\\ftech Symbol;}}\
- {\\stylesheet\
- {\\s1 \\f5\\fs20 \\sbasedon0\\snext1 name;}\
- {\\s2 \\f3\\fs20 \\sbasedon0\\snext2 num;}\
- {\\s3 \\f1\\f21 \\sbasedon0\\snext3 seq;}}";
-
- char *rtftail = "}";
- ****/
-
-
-
-
-
-
- short writeSeq(FILE *outf, const char *seq, const long seqlen,
- const short outform, const char *seqid)
- {
- gFile = outf; gLinestart = 0;
- return writeSeqCall( readWriteFromFile, seq, seqlen, outform, seqid);
- }
-
-
- short writeSeqCall(
- ReadWriteProc writer,
- const char *seq, const long seqlen,
- const short outform, const char *seqid)
- /* dump sequence to standard output */
- {
- const short kSpaceAll = -9;
- #define kMaxseqwidth 250
-
- boolean baseonlynum= false; /* nocountsymbols -- only count true bases, not "-" */
- short numline = 0; /* only true if we are writing seq number line (for interleave) */
- boolean numright = false, numleft = false;
- boolean nameright = false, nameleft = false, dumb = true;
- short namewidth = 8, numwidth = 8;
- short spacer = 0, width = 50, tab = 0;
- /* new parameters: width, spacer, those above... */
-
- short linesout = 0, seqtype = kNucleic;
- long i, j, l, l1, ibase;
- char idword[31], endstr[30];
- char seqnamestore[128], *seqname = seqnamestore;
- char s[kMaxseqwidth], *cp;
- char nameform[30], numform[30], nocountsymbols[30];
- unsigned long checksum = 0, checktotal = 0;
- char outbuf[512];
-
- #define FPUTC(c) {outbuf[0]=c; outbuf[1]=0; (void)(*writer)(outbuf, 255, kRSFile_Write);}
- #define FPUTS(s) (void)(*writer)(outbuf, 255L, kRSFile_Write)
-
- /*fprintf(stderr,"writeSeqCall &writer= %ld &gFile= %ld\n", writer, gFile);*/
-
- gPretty.atseq++;
- /* skipwhitespace(seqid); //???? */
- strncpy( seqnamestore, seqid, sizeof(seqnamestore));
- seqname[sizeof(seqnamestore)-1] = 0;
-
- sscanf( seqname, "%30s", idword);
- sprintf(numform, "%d", seqlen);
- numwidth= strlen(numform)+1;
- nameform[0]= '\0';
-
- if (strstr(seqname,"checksum") != NULL) {
- cp = strstr(seqname,"bases");
- if (cp!=NULL) {
- for ( ; (cp!=seqname) && (*cp!=','); cp--) ;
- if (cp!=seqname) *cp=0;
- }
- }
-
- strcpy( endstr,"");
- l1 = 0;
-
- if (outform == kGCG || outform == kMSF) {
- /* ! translate quasi-standard '-' indel to '.' that gcg uses */
- /* must do before checksum... */
- checksum = GCGchecksum(seq, seqlen, &checktotal);
- }
- else
- checksum = seqchecksum(seq, seqlen, &checktotal);
-
- switch (outform) {
-
- case kPlain:
- case kUnknown: /* no header, just sequence */
- strcpy(endstr,"\n"); /* end w/ extra blank line */
- break;
-
- case kOlsen: /* Olsen seq. editor takes plain nucs OR Genbank */
- case kGenBank:
- sprintf(outbuf,"LOCUS %s %d bp\n", idword, seqlen); FPUTS(outbuf);
- sprintf(outbuf,"DEFINITION %s %d bases %X checksum\n",
- seqname, seqlen, checksum); FPUTS(outbuf);
- /* sprintf(outbuf,"ACCESSION %s\n", accnum); FPUTS(outbuf); */
- sprintf(outbuf,"ORIGIN \n" ); FPUTS(outbuf);
- spacer = 11;
- numleft = true;
- numwidth = 8; /* dgg. 1Feb93, patch for GDE fail to read short numwidth */
- strcpy(endstr, "\n//");
- linesout += 4;
- break;
-
- case kPIR:
- /* somewhat like genbank... \\\*/
- /* sprintf(outbuf,"\\\\\\\n"); FPUTS(outbuf); << only at top of file, not each entry... */
- sprintf(outbuf,"ENTRY %s \n", idword); FPUTS(outbuf);
- sprintf(outbuf,"TITLE %s %d bases %X checksum\n",
- seqname, seqlen, checksum); FPUTS(outbuf);
- /* sprintf(outbuf,"ACCESSION %s\n", accnum); FPUTS(outbuf); */
- sprintf(outbuf,"SEQUENCE \n" ); FPUTS(outbuf);
- numwidth = 7;
- width= 30;
- spacer = kSpaceAll;
- numleft = true;
- strcpy(endstr, "\n///");
- /* run a top number line for PIR */
- for (j=0; j<numwidth; j++) FPUTC(' ');
- for (j= 5; j<=width; j += 5) { sprintf(outbuf,"%10d", j ); FPUTS(outbuf); }
- FPUTC('\n');
- linesout += 5;
- break;
-
- case kNBRF:
- if (getseqtype(seq, seqlen) == kAmino)
- { sprintf(outbuf,">P1;%s\n", idword ); FPUTS(outbuf);}
- else
- { sprintf(outbuf,">DL;%s\n", idword ); FPUTS(outbuf);}
- sprintf(outbuf,"%s %d bases %X checksum\n",
- seqname, seqlen, checksum); FPUTS(outbuf);
- spacer = 11;
- strcpy(endstr,"*\n");
- linesout += 3;
- break;
-
- case kEMBL:
- sprintf(outbuf,"ID %s\n", idword ); FPUTS(outbuf);
- /* sprintf(outbuf,"AC %s\n", accnum ); FPUTS(outbuf); */
- sprintf(outbuf,"DE %s %d bases %X checksum\n",
- seqname, seqlen, checksum); FPUTS(outbuf);
- sprintf(outbuf,"SQ %d BP\n", seqlen ); FPUTS(outbuf);
- strcpy(endstr, "\n//"); /* 11Oct90: bug fix*/
- tab = 4; /** added 31jan91 */
- spacer = 11; /** added 31jan91 */
- width = 60;
- linesout += 4;
- break;
-
- case kGCG:
- sprintf(outbuf,"%s\n", seqname ); FPUTS(outbuf);
- /* sprintf(outbuf,"ACCESSION %s\n", accnum ); FPUTS(outbuf);*/
- sprintf(outbuf," %s Length: %d (today) Check: %d ..\n",
- idword, seqlen, checksum ); FPUTS(outbuf);
- spacer = 11;
- numleft = true;
- strcpy(endstr, "\n"); /* this is insurance to help prevent misreads at eof */
- linesout += 3;
- break;
-
- case kStrider: /* ?? map ?*/
- sprintf(outbuf,"; ### from DNA Strider ;-)\n" ); FPUTS(outbuf);
- sprintf(outbuf,"; DNA sequence %s %d bases %X checksum\n;\n",
- seqname, seqlen, checksum); FPUTS(outbuf);
- strcpy(endstr, "\n//");
- linesout += 3;
- break;
-
- case kFitch:
- sprintf(outbuf,"%s %d bases %X checksum\n",
- seqname, seqlen, checksum); FPUTS(outbuf);
- spacer = 4;
- width = 60;
- linesout += 1;
- break;
-
- case kPhylip2:
- case kPhylip4:
- /* this is version 3.2/3.4 -- simplest way to write
- version 3.3 is to write as version 3.2, then
- re-read file and interleave the species lines */
- if (strlen(idword)>10) idword[10] = 0;
- sprintf(outbuf,"%-10s ", idword ); FPUTS(outbuf);
- l1 = -1;
- tab = 12;
- spacer = 11;
- break;
-
- case kASN1:
- seqtype= getseqtype(seq, seqlen);
- switch (seqtype) {
- case kDNA : cp= "dna"; break;
- case kRNA : cp= "rna"; break;
- case kNucleic : cp= "na"; break;
- case kAmino : cp= "aa"; break;
- case kOtherSeq: cp= "not-set"; break;
- }
- sprintf(outbuf," seq {\n" ); FPUTS(outbuf);
- sprintf(outbuf," id { local id %d },\n", gPretty.atseq ); FPUTS(outbuf);
- sprintf(outbuf," descr { title \"%s\" },\n", seqid ); FPUTS(outbuf);
- sprintf(outbuf," inst {\n", dumb ); FPUTS(outbuf);
- sprintf(outbuf," repr raw, mol %s, length %d, topology linear,\n",
- cp, seqlen ); FPUTS(outbuf);
- sprintf(outbuf," seq-data\n" ); FPUTS(outbuf);
- if (seqtype == kAmino)
- { sprintf(outbuf," iupacaa \""); FPUTS(outbuf);}
- else
- { sprintf(outbuf," iupacna \"" ); FPUTS(outbuf);}
- l1 = 17;
- spacer = 0;
- width = 78;
- tab = 0;
- strcpy(endstr,"\"\n } } ,");
- linesout += 7;
- break;
-
- case kPAUP:
- nameleft= true;
- namewidth = 9;
- spacer = 21;
- width = 100;
- tab = 0; /* 1; */
- /* strcpy(endstr,";\nend;"); << this is end of all seqs.. */
- /* do a header comment line for paup */
- sprintf(outbuf,"[Name: %-16s Len:%6d Check: %8X]\n",
- idword, seqlen, checksum ); FPUTS(outbuf);
- linesout += 1;
- break;
-
- case kPretty:
- numline= gPretty.numline;
- baseonlynum= gPretty.baseonlynum;
- namewidth = gPretty.namewidth;
- numright = gPretty.numright;
- numleft = gPretty.numleft;
- nameright = gPretty.nameright;
- nameleft = gPretty.nameleft;
- spacer = gPretty.spacer + 1;
- width = gPretty.seqwidth;
- tab = gPretty.tab;
- /* also add rtf formatting w/ font, size, style */
- if (gPretty.nametop) {
- sprintf(outbuf,"Name: %-16s Len:%6d Check: %8X\n",
- idword, seqlen, checksum ); FPUTS(outbuf);
- linesout++;
- }
- break;
-
- case kMSF:
- sprintf(outbuf," Name: %-16s Len:%6d Check:%5d Weight: 1.00\n",
- idword, seqlen, checksum ); FPUTS(outbuf);
- linesout++;
- nameleft= true;
- namewidth= 15; /* need MAX namewidth here... */
- sprintf(nameform, "%%+%ds ",namewidth);
- spacer = 11;
- width = 50;
- tab = 0; /* 1; */
- break;
-
- case kIG:
- sprintf(outbuf,";%s %d bases %X checksum\n",
- seqname, seqlen, checksum ); FPUTS(outbuf);
- sprintf(outbuf,"%s\n", idword ); FPUTS(outbuf);
- strcpy(endstr,"1"); /* == linear dna */
- linesout += 2;
- break;
-
- default :
- case kZuker: /* don't attempt Zuker's ftn format */
- case kPearson:
- sprintf(outbuf,">%s %d bases %X checksum\n",
- seqname, seqlen, checksum ); FPUTS(outbuf);
- linesout += 1;
- break;
- }
-
- if (*nameform==0) sprintf(nameform, "%%%d.%ds ",namewidth,namewidth);
- if (numline) sprintf(numform, "%%%ds ",numwidth);
- else sprintf(numform, "%%%dd ",numwidth);
- strcpy( nocountsymbols, kNocountsymbols);
- if (baseonlynum) {
- if (strchr(nocountsymbols,gPretty.gapchar)==NULL) {
- strcat(nocountsymbols," ");
- nocountsymbols[strlen(nocountsymbols)-1]= gPretty.gapchar;
- }
- if (gPretty.domatch && (cp=strchr(nocountsymbols,gPretty.matchchar))!=NULL) {
- *cp= ' ';
- }
- }
-
- if (numline) {
- *idword= 0;
- }
-
- width = min(width,kMaxseqwidth);
- for (i=0, l=0, ibase = 1; i < seqlen; ) {
-
- if (l1 < 0) l1 = 0;
- else if (l1 == 0) {
- if (nameleft) { sprintf(outbuf, nameform, idword ); FPUTS(outbuf);}
- if (numleft) { if (numline) { sprintf(outbuf, numform, "" ); FPUTS(outbuf);}
- else { sprintf(outbuf, numform, ibase ); FPUTS(outbuf);}
- }
- for (j=0; j<tab; j++) FPUTC(' ');
- }
-
- l1++; /* don't count spaces for width*/
- if (numline) {
- if (spacer==kSpaceAll || (spacer != 0 && (l+1) % spacer == 1)) {
- if (numline==1) FPUTC(' ');
- s[l++] = ' ';
- }
- if (l1 % 10 == 1 || l1 == width) {
- if (numline==1) { sprintf(outbuf,"%-9d ", i+1 ); FPUTS(outbuf);}
- s[l++]= '|'; /* == put a number here */
- }
- else s[l++]= ' ';
- i++;
- }
-
- else {
- if (spacer==kSpaceAll || (spacer != 0 && (l+1) % spacer == 1))
- s[l++] = ' ';
- if (!baseonlynum) ibase++;
- else if (0==strchr(nocountsymbols,seq[i])) ibase++;
- s[l++] = seq[i++];
- }
-
- if (l1 == width || i == seqlen) {
- if (outform==kPretty) for ( ; l1<width; l1++) {
- if (spacer==kSpaceAll || (spacer != 0 && (l+1) % spacer == 1))
- s[l++] = ' ';
- s[l++]=' '; /* pad w/ blanks */
- }
- s[l] = '\0';
- l = 0; l1 = 0;
-
- if (numline) {
- if (numline==2) { sprintf(outbuf,"%s", s ); FPUTS(outbuf);} /* finish numberline ! and | */
- }
- else {
- if (i == seqlen) { sprintf(outbuf,"%s%s", s,endstr ); FPUTS(outbuf); }
- else { sprintf(outbuf,"%s", s ); FPUTS(outbuf);}
- if (numright || nameright) FPUTC(' ');
- if (numright) { sprintf(outbuf,numform, ibase-1 ); FPUTS(outbuf);}
- if (nameright) { sprintf(outbuf, nameform, idword ); FPUTS(outbuf);}
- }
- FPUTC('\n');
- linesout++;
- }
- }
- return linesout;
-
- #undef FPRINTF
- #undef FPUTC
- } /*writeSeq*/
-
-
-
- /* End file: ureadseq.c */
-